Stem-loop sequence eca-mir-193b

AccessionMI0012800 (change log)
DescriptionEquus caballus miR-193b stem-loop
Gene family MIPF0000082; mir-193
Literature search

2 open access papers mention eca-mir-193b
(2 sentences)

Stem-loop
        u    gu    a    g  a  ag uua 
5' cagaa cggg  uuug gggc ag ug  u   u
   ||||| ||||  |||| |||| || ||  |   g
3' guuuu gccc  aaac cccg uc ac  a   u
        c    ug    a    g  a  cu uuu 
Get sequence
Deep sequencing
295 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr13: 30687480-30687548 [-]
sense
ENSECAT00000027673 ; eca-mir-193b-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-193b
eca-mir-193bchr13: 30687480-30687548 [-]
eca-mir-365-2chr13: 30682630-30682716 [-]
Database links

Mature sequence eca-miR-193b

Accession MIMAT0013056
Sequence

44 - 

aacuggcccacaaagucccgcu

 - 65

Get sequence
Deep sequencing290 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).