Stem-loop sequence eca-mir-130a

AccessionMI0012790 (change log)
DescriptionEquus caballus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention eca-mir-130a
(1 sentences)

Stem-loop
   ga        c      ug  a   uc  ca 
5'   gcucuuuu acauug  cu cug  ug  c
     |||||||| ||||||  || |||  ||  c
3'   cgggaaaa uguaac  ga gau  ac  u
   ua        u      gu  c   -c  ca 
Get sequence
Deep sequencing
3680 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 17657890-17657953 [+]
intergenic
Database links

Mature sequence eca-miR-130a

Accession MIMAT0013047
Sequence

43 - 

cagugcaauguuaaaagggcau

 - 64

Get sequence
Deep sequencing3678 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).