Stem-loop sequence eca-mir-324

AccessionMI0012780 (change log)
DescriptionEquus caballus miR-324 stem-loop
Gene family MIPF0000165; mir-324
Literature search

1 open access papers mention eca-mir-324
(2 sentences)

Stem-loop
   cu      gc     c   u c   a     u   u  aaag 
5'   gacuau  cuccc gca c ccu gggca ugg gu    c
     ||||||  ||||| ||| | ||| ||||| ||| ||     
3'   cugaug  ggggg cgu g gga cccgu acc ca    u
   --      uu     u   c u   c     c   -  gagg 
Get sequence
Deep sequencing
105 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 50242526-50242608 [-]
antisense
ENSECAT00000026882 ; ACADVL-201; intron 12
Database links

Mature sequence eca-miR-324-5p

Accession MIMAT0013033
Sequence

16 - 

cgcauccccuagggcauuggugu

 - 38

Get sequence
Deep sequencing62 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-324-3p

Accession MIMAT0013034
Sequence

51 - 

ccacugccccaggugcugcugg

 - 72

Get sequence
Deep sequencing41 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).