Stem-loop sequence eca-mir-301a

AccessionMI0012779 (change log)
DescriptionEquus caballus miR-301a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   g     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
1828 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 33292426-33292511 [-]
sense
ENSECAT00000015691 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-301a
eca-mir-301achr11: 33292426-33292511 [-]
eca-mir-454chr11: 33283292-33283360 [-]
Database links

Mature sequence eca-miR-301a

Accession MIMAT0013032
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Deep sequencing1818 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).