Stem-loop sequence eca-mir-193a

AccessionMI0012773 (change log)
DescriptionEquus caballus miR-193a stem-loop
Gene family MIPF0000082; mir-193
Literature search

2 open access papers mention eca-mir-193a
(4 sentences)

Stem-loop
   -   a             u     cg   g  a    ggu 
5'  ggg gcugagggcuggg cuuug  ggc ag ugag   g
    ||| ||||||||||||| |||||  ||| || ||||    
3'  ccc cggcuucugaccc gaaac  ccg uc acuu   u
   g   c             u     au   g  a    gac 
Get sequence
Deep sequencing
50 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 40807843-40807923 [-]
intergenic
Database links

Mature sequence eca-miR-193a-5p

Accession MIMAT0013025
Sequence

14 - 

ugggucuuugcgggcgagauga

 - 35

Get sequence
Deep sequencing23 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-193a-3p

Accession MIMAT0013026
Sequence

48 - 

aacuggccuacaaagucccagu

 - 69

Get sequence
Deep sequencing27 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).