Stem-loop sequence eca-mir-132

AccessionMI0012770 (change log)
DescriptionEquus caballus miR-132 stem-loop
Gene family MIPF0000065; mir-132
Literature search

1 open access papers mention eca-mir-132
(3 sentences)

Stem-loop
   -  a a         uuc          -g     
5'  gg c accguggcu   gauuguuacu  uggg 
    || | |||||||||   ||||||||||  ||| a
3'  cc g ugguaccga   cugacaaugg  gcca 
   c  - c         cau          ag     
Get sequence
Deep sequencing
168 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 45639836-45639901 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-132
eca-mir-212chr11: 45640251-45640310 [-]
eca-mir-132chr11: 45639836-45639901 [-]
Database links

Mature sequence eca-miR-132

Accession MIMAT0013021
Sequence

42 - 

uaacagucuacagccauggucg

 - 63

Get sequence
Deep sequencing154 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).