Stem-loop sequence eca-mir-150

AccessionMI0012762 (change log)
DescriptionEquus caballus miR-150 stem-loop
Gene family MIPF0000197; mir-150
Literature search

1 open access papers mention eca-mir-150
(3 sentences)

Stem-loop
               acc          -u    u 
5' cccugucuccca   cuuguaccag  gcug g
   ||||||||||||   ||||||||||  |||| c
3' gggacggggggu   ggacaugguc  uggc c
               -ac          cc    u 
Get sequence
Deep sequencing
809 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr10: 19329710-19329774 [-]
intergenic
Database links

Mature sequence eca-miR-150

Accession MIMAT0013011
Sequence

6 - 

ucucccaacccuuguaccagug

 - 27

Get sequence
Deep sequencing809 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).