Stem-loop sequence eca-mir-187

AccessionMI0012751 (change log)
DescriptionEquus caballus miR-187 stem-loop
Gene family MIPF0000078; mir-187
Literature search

1 open access papers mention eca-mir-187
(1 sentences)

Stem-loop
   ucg    a           - --c   -  cu 
5'    ggcu caacacgggac c   ggg cg  g
      |||| ||||||||||| |   ||| ||   
3'    ccga guuguguucug g   ccc gc  c
   -gg    c           u cuc   a  cu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr8: 56143025-56143085 [-]
sense
ENSECAT00000027300 ; eca-mir-187-201; exon 1
Database links

Mature sequence eca-miR-187

Accession MIMAT0012999
Sequence

40 - 

ucgugucuuguguugcagccgg

 - 61

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).