Stem-loop sequence eca-mir-130b

AccessionMI0012748 (change log)
DescriptionEquus caballus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention eca-mir-130b
(1 sentences)

Stem-loop
         c    ca       cc         acugugg   gc 
5' ggccug cuga  cucuuuc  uguugcacu       gcu  u
   |||||| ||||  |||||||  |||||||||       |||   
3' ccggac ggcu  gggaaag  guaacguga       cga  g
         u    ac       ua         -------   ag 
Get sequence
Deep sequencing
86 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr8: 3383110-3383190 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-130b
eca-mir-301bchr8: 3382779-3382875 [+]
eca-mir-130bchr8: 3383110-3383190 [+]
Database links

Mature sequence eca-miR-130b

Accession MIMAT0012996
Sequence

50 - 

cagugcaaugaugaaagggcau

 - 71

Get sequence
Deep sequencing69 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).