Stem-loop sequence eca-mir-27a

AccessionMI0012739 (change log)
DescriptionEquus caballus miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

2 open access papers mention eca-mir-27a
(2 sentences)

Stem-loop
   cu    a  a         ug  u       -  g  ca 
5'   gggg gc gggcuuagc  cu gugagca gg uc  c
     |||| || |||||||||  || ||||||| || ||   
3'   cccc cg cuugaaucg  ga cacuugu cu ag  a
   -g    c  c         gu  -       a  g  cc 
Get sequence
Deep sequencing
78628 reads, 5.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 44930014-44930090 [+]
antisense
ENSECAT00000009158 ; IER2-201; intron 5
Clustered miRNAs
< 10kb from eca-mir-27a
eca-mir-23achr7: 44929817-44929889 [+]
eca-mir-27achr7: 44930014-44930090 [+]
eca-mir-24-1chr7: 44930163-44930230 [+]
eca-mir-8992chr7: 44932141-44932243 [+]
Database links

Mature sequence eca-miR-27a

Accession MIMAT0012988
Sequence

51 - 

uucacaguggcuaaguuccgc

 - 71

Get sequence
Deep sequencing78618 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).