Stem-loop sequence eca-mir-125b

AccessionMI0012733 (change log)
DescriptionEquus caballus miR-125b stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention eca-mir-125b
(2 sentences)

Stem-loop
   u    uc   u  -a    u    c           au     c 
5'  gcgc  cuc ca  uccc gaga ccuaacuugug  guuua c
    ||||  ||| ||  |||| |||| |||||||||||  ||||| g
3'  cgug  gag gu  aggg uucu ggauugggcac  uaaau u
   c    cu   c  cg    -    c           -c     u 
Get sequence
Deep sequencing
26310 reads, 1.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 29499965-29500052 [-]
intergenic
Database links

Mature sequence eca-miR-125b-5p

Accession MIMAT0012981
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing51843 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).