Stem-loop sequence eca-mir-199a

AccessionMI0012712 (change log)
DescriptionEquus caballus miR-199a stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention eca-mir-199a
(5 sentences)

Stem-loop
       c   gcc       u        c   --uca  ac 
5' gcuc guc   ccagugu cagacuac ugu     gg  a
   |||| |||   ||||||| |||||||| |||     ||   
3' cggg cag   gguuaca gucugaug aca     cc  a
       u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
73690 reads, 4.95e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 8104732-8104810 [-]
sense
ENSECAT00000027624 ; eca-mir-199a-201; exon 1
antisense
ENSECAT00000029159 ; DNM3-204; intron 14
Clustered miRNAs
< 10kb from eca-mir-199a
eca-mir-199achr5: 8104732-8104810 [-]
eca-mir-214chr5: 8098955-8099019 [-]
Database links

Mature sequence eca-miR-199a-5p

Accession MIMAT0012960
Sequence

11 - 

cccaguguucagacuaccuguuc

 - 33

Get sequence
Deep sequencing14590 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-199a-3p

Accession MIMAT0012961
Sequence

50 - 

acaguagucugcacauugguua

 - 71

Get sequence
Deep sequencing59099 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).