Stem-loop sequence eca-mir-138-1

AccessionMI0012681 (change log)
Previous IDseca-mir-138
DescriptionEquus caballus miR-138 stem-loop
Gene family MIPF0000075; mir-138
Literature search

1 open access papers mention eca-mir-138-1
(2 sentences)

Stem-loop
   c u   u  ag             uca     -ac   c  ug 
5'  g ugc gc  cugguguugugaa   ggccg   gag ag  c
    | ||| ||  |||||||||||||   |||||   ||| ||   
3'  c acg ug  gaccacagcacuu   ucggc   uuc uc  a
   a u   u  -g             -ua     cca   -  cu 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 9201079-9201162 [+]
intergenic
Database links

Mature sequence eca-miR-138

Accession MIMAT0012925
Sequence

10 - 

agcugguguugugaaucaggccg

 - 32

Get sequence
Deep sequencing60 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).