Stem-loop sequence bmo-mir-2751

AccessionMI0012203 (change log)
DescriptionBombyx mori miR-2751 stem-loop
Stem-loop
   a   auc   u     -a  c     cuc  cg     g     aa  -ac   a 
5'  ccu   gag augcu  gc gccua   ac  cagcg agcgc  cu   ucu c
    |||   ||| |||||  || |||||   ||  ||||| |||||  ||   ||| u
3'  gga   cuu ugcga  ug cgggu   ug  gucgu ucgcg  gg   aga a
   c   ---   -     gg  c     --c  au     -     aa  gca   c 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581687.1: 2575994-2576097 [-]
intergenic
NW_004610308.1: 174-277 [-]
intergenic
Database links

Mature sequence bmo-miR-2751

Accession MIMAT0012631
Sequence

80 - 

gucugggccguggagcguuu

 - 99

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; cloned [1], RT-PCR [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).