Stem-loop sequence bmo-mir-2738

AccessionMI0012187 (change log)
DescriptionBombyx mori miR-2738 stem-loop
Stem-loop
   -      --------------    c  aau    aa      uuaccauu      -  --    u 
5'  auucuc              ugau ua   gaug  uguucu        aaaaga cu  gaua g
    ||||||              |||| ||   ||||  ||||||        |||||| ||  ||||  
3'  uaaggg              acua gu   cuac  gcaaga        uuuucu ga  uuau a
   a      uuuaaaucaaaaau    a  agu    cg      --------      a  ag    a 
Get sequence
Deep sequencing
1237 reads, 133 reads per million, 3 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581709.1: 901880-901989 [-]
intergenic
Database links

Mature sequence bmo-miR-2738

Accession MIMAT0012616
Sequence

61 - 

aucuuuuagaacggccaucugaug

 - 84

Get sequence
Deep sequencing1151 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1]
Database links

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).