Stem-loop sequence bmo-mir-2736

AccessionMI0012185 (change log)
DescriptionBombyx mori miR-2736 stem-loop
Stem-loop
   u  ua  ---aaaa          a  agca     uu  a  ua 
5'  gu  cc       cgucgauggu cc    gagcc  gu uc  c
    ||  ||       |||||||||| ||    |||||  || ||   
3'  ca  gg       gcaguugcua gg    uucgg  cg gg  g
   u  gg  cgcgacc          -  --gc     --  a  uc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581728.1: 82270-82353 [+]
intergenic
Database links

Mature sequence bmo-miR-2736

Accession MIMAT0012614
Sequence

4 - 

uaccaaaacgucgaugguaccagcag

 - 29

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1], RT-PCR [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).