Stem-loop sequence bmo-mir-2734

AccessionMI0012183 (change log)
DescriptionBombyx mori miR-2734 stem-loop
Stem-loop
   c   uuu   -  -       ugu     a uc  --   u     u 
5'  agu   aga gc uuugucg   cuggu g  gc  guu uccuu u
    |||   ||| || |||||||   ||||| |  ||  ||| |||||  
3'  ucg   ucu cg gaacagc   ggcca u  ug  cga aggag a
   c   uuu   u  u       ---     a uu  au   u     g 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581689.1: 43975-44063 [-]
intergenic
Database links

Mature sequence bmo-miR-2734

Accession MIMAT0012612
Sequence

13 - 

uuugucgugucugguagucgc

 - 33

Get sequence
Evidence experimental; cloned [1], RT-PCR [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).