Stem-loop sequence bmo-mir-2729

AccessionMI0012177 (change log)
DescriptionBombyx mori miR-2729 stem-loop
Stem-loop
   a     cauuuau c g   u a    c     uu   a  u   --    uc 
5'  gcaag       g u gag g guaa agauu  aug gg cgg  ucca  g
    |||||       | | ||| | |||| |||||  ||| || |||  ||||   
3'  cguuc       c a cuc c cguu ucuag  ugc cc gcu  aggu  u
   a     --ccuuu - g   - -    u     --   g  u   ag    ug 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581743.1: 826687-826785 [-]
intergenic
Database links

Mature sequence bmo-miR-2729

Accession MIMAT0012606
Sequence

31 - 

auuuuaugaggucgguccau

 - 50

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).