![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-2682 |
||||||
Accession | MI0012063 (change log) | |||||
Symbol | HGNC:MIR2682 | |||||
Description | Homo sapiens miR-2682 stem-loop | |||||
Literature search |
3 open access papers mention hsa-mir-2682 | |||||
Stem-loop |
-------ac u --- u c a uuc a aauc 5' c uccugaa agaggu gggg aggcagug cug ag cgucc u | ||||||| |||||| |||| |||||||| ||| || ||||| 3' g aggauuu ucuccg cccu ucugucgc gac uc gcagg c aaacucuga c ccg u - - uuc c guuu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-2682-5p |
|
Accession | MIMAT0013517 |
Previous IDs | hsa-miR-2682 |
Sequence |
23 - caggcagugacuguucagacguc - 45 |
Deep sequencing | 399 reads, 24 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-2682-3p |
|
Accession | MIMAT0013518 |
Previous IDs | hsa-miR-2682* |
Sequence |
60 - cgccucuucagcgcugucuucc - 81 |
Deep sequencing | 37 reads, 17 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|