Stem-loop sequence hsa-mir-2682

AccessionMI0012063 (change log)
Symbol HGNC:MIR2682
DescriptionHomo sapiens miR-2682 stem-loop
Literature search

3 open access papers mention hsa-mir-2682
(3 sentences)

Stem-loop
   -------ac u       ---      u    c        a   uuc  a     aauc 
5'          c uccugaa   agaggu gggg aggcagug cug   ag cgucc    u
            | |||||||   |||||| |||| |||||||| |||   || |||||     
3'          g aggauuu   ucuccg cccu ucugucgc gac   uc gcagg    c
   aaacucuga c       ccg      u    -        -   uuc  c     guuu 
Get sequence
Deep sequencing
451 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 98045242-98045351 [-]
sense
OTTHUMT00000095698 ; DPYD-001; intron 10
ENST00000370192 ; DPYD-001; intron 10
Clustered miRNAs
< 10kb from hsa-mir-2682
hsa-mir-137chr1: 98046070-98046171 [-]
hsa-mir-2682chr1: 98045242-98045351 [-]
Database links

Mature sequence hsa-miR-2682-5p

Accession MIMAT0013517
Previous IDshsa-miR-2682
Sequence

23 - 

caggcagugacuguucagacguc

 - 45

Get sequence
Deep sequencing399 reads, 24 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-2682-3p

Accession MIMAT0013518
Previous IDshsa-miR-2682*
Sequence

60 - 

cgccucuucagcgcugucuucc

 - 81

Get sequence
Deep sequencing37 reads, 17 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).