Stem-loop sequence bdi-MIR397a

Accession

MI0011565 (change log)

Previous IDs

bdi-MIR397

Description

Brachypodium distachyon miR397a stem-loop

Gene family

MIPF0000120; MIR397

Literature search

2 open access papers mention bdi-MIR397a
(11 sentences)

Stem-loop

   --------ga     -c    a   a      a           a     ag     ag c        
5'           agagg  gcaa ggc ucauug gugcagcguug ugaac  gggcc  g gaccggc 
             |||||  |||| ||| |||||| ||||||||||| |||||  |||||  | |||||| g
3'           ucucu  cguu ccg agugac cacgucgcggc acuug  cuugg  c cuggccg 
   cuuagcccgg     ua    c   c      a           c     -g     -- -        

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Bd21; GCA_000005505.1): 3: 3149697-3149820 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0011565

Mature sequence bdi-miR397a

• Accession: MIMAT0012180
• Previous IDs: bdi-miR397
• Sequence: 18 - ucauugagugcagcguugaug - 38
• Evidence: by similarity; MI0001015

References

1. PMID:19585143 "Conserved microRNAs and their targets in model grass species Brachypodium distachyon" Unver T, Budak H Planta. 230:659-669(2009).
2. PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).