Stem-loop sequence bdi-MIR167a

Accession

MI0011561 (change log)

Previous IDs

bdi-MIR167

Description

Brachypodium distachyon miR167a stem-loop

Gene family

MIPF0000023; MIR167_1

Literature search

2 open access papers mention bdi-MIR167a
(8 sentences)

Stem-loop

   -------------------------a   aaa  -   aa   -    g  ug -  u 
5'                           gag   gc gug  gcu gcca ca  a uc a
                             |||   || |||  ||| |||| ||  | || u
3'                           cuu   cg cac  uga cggu gu  u ag c
   cggccggggcuucggugccgcaacga   aaa  a   cg   a    g  gu c  u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Bd21; GCA_000005505.1): 1: 6349045-6349135 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0011561

Mature sequence bdi-miR167a

• Accession: MIMAT0012176
• Previous IDs: bdi-miR167
• Sequence: 11 - ugaagcugccagcaugaucua - 31
• Evidence: experimental; qRT-PCR [1]

References

1. PMID:19585143 "Conserved microRNAs and their targets in model grass species Brachypodium distachyon" Unver T, Budak H Planta. 230:659-669(2009).
2. PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).