Stem-loop sequence cbr-mir-76

AccessionMI0010977 (change log)
DescriptionCaenorhabditis briggsae miR-76 stem-loop
Gene family MIPF0000902; mir-76
Stem-loop
        u  uu  -   a           -     u       -   cca 
5' auccc ca  cg cca uuaggacuuca caaca gcgaaua cca   c
   ||||| ||  || ||| ||||||||||| ||||| ||||||| |||   u
3' ugggg gu  gc ggu aauucugaagu guugu ugcuuau ggu   u
        c  cu  a   -           a     -       a   auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 2936452-2936547 [-]
intergenic
Database links

Mature sequence cbr-miR-76

Accession MIMAT0011466
Sequence

59 - 

uucguuguugaugaagucuu

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).