Stem-loop sequence sbi-MIR437e

AccessionMI0010906 (change log)
DescriptionSorghum bicolor miR437e stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437e
(5 sentences)

Stem-loop
   ----      --a              cauug  u    uacuaaaucaauua 
5'     cagauu   cugauuuugaucaa     uc gaaa              g
       ||||||   ||||||||||||||     || ||||               
3'     guuuga   gauugaaacugguu     ag cuuu              a
   uuca      aga              -caaa  u    uuauauauaauugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 61313938-61314038 [+]
intergenic
Database links

Mature sequence sbi-miR437e

Accession MIMAT0011366
Sequence

81 - 

aaaguuagagaaguuugacuu

 - 101

Get sequence
Evidence not experimental

References

1
" Zhang L, Ware D Unpublished (2009).