Stem-loop sequence mtr-MIR2086

AccessionMI0010539 (change log)
DescriptionMedicago truncatula miR2086 stem-loop
Gene family MIPF0001302; MIR2086
Literature search

1 open access papers mention mtr-MIR2086
(1 sentences)

Stem-loop 
   --uuc    a                         c  ca      c   a 
5'      acca cuuuccaguucugcguucauguccc ug  gcuuga uuu g
        |||| ||||||||||||||||||||||||| ||  |||||| |||  
3'      uggu gaaaggucaagacguaaguacaggg ac  cgagcu aag g
   gaguc    a                         a  aa      a   g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 31686255-31686356 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2086
mtr-MIR2086chr2: 31686255-31686356 [-]
mtr-MIR2651chr2: 31685421-31685567 [-]
Database links

Mature sequence mtr-miR2086-5p

Accession MIMAT0010026
Previous IDsmtr-miR2086*
Sequence

13 -  

ccaguucugcguucauguccc

 - 33

Get sequence
Evidence experimental; Illumina [1], Northern [1]

Mature sequence mtr-miR2086-3p

Accession MIMAT0010027
Previous IDsmtr-miR2086
Sequence

70 -  

gacaugaaugcagaacuggaa

 - 90

Get sequence
Evidence experimental; Illumina [1], Northern [1], 454 [2]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).