Stem-loop sequence osa-MIR2055

Accession

MI0010489 (change log)

Description

Oryza sativa miR2055 stem-loop

Literature search

3 open access papers mention osa-MIR2055
(25 sentences)

Stem-loop

         u    g    ag          cacagacauugacacgcaauu 
5' agaaga ggag cacc  cccaaggaaa                     c
   |||||| |||| ||||  ||||||||||                     a
3' ucuucu cuuu gugg  ggguuccuuu                     a
         -    g    aa          uucauccugcguuagaagagg 

Deep sequencing

394 reads, 200 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr9: 431432-431531 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0010489

Mature sequence osa-miR2055

• Accession: MIMAT0009980
• Sequence: 74 - uuuccuugggaaggugguuuc - 94
• Deep sequencing: 289 reads, 2 experiments
• Evidence: experimental; cloned [1]
• Database links:
  • RNAcentral:URS000049858A_39947

References

1. PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).