![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1976 |
|||||
Accession | MI0009986 (change log) | ||||
Symbol | HGNC:MIR1976 | ||||
Description | Homo sapiens miR-1976 stem-loop | ||||
Gene family | MIPF0001633; mir-1976 | ||||
Literature search |
![]()
3 open access papers mention hsa-mir-1976 | ||||
Stem-loop |
a uc uaa 5' gcagcaagga ggcagggg c g |||||||||| |||||||| | 3' ugucguuccu ccguccuc g g c cu ugu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-1976 |
|
Accession | MIMAT0009451 |
Sequence |
33 - ccuccugcccuccuugcugu - 52 |
Deep sequencing | 120 reads, 40 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:18923441
"Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia"
Leukemia. 23:313-322(2009).
|