![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dsi-mir-318 |
|||||
Accession | MI0009474 (change log) | ||||
Description | Drosophila simulans miR-318 stem-loop | ||||
Gene family | MIPF0000259; mir-318 | ||||
Stem-loop |
u c c uu caca 5' uuaugggaua aca aguucagu ugu c |||||||||| ||| |||||||| ||| 3' aguacucuau ugu ucggguca acg u g u u cu aauu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dsi-miR-318 |
|
Accession | MIMAT0008907 |
Sequence |
43 - ucacugggcuuuguuuaucuca - 64 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Nature. 450:203-218(2007).
|
2 |
PMID:20037610
"Evolutionary flux of canonical microRNAs and mirtrons in Drosophila"
Nat Genet. 42:6-9(2010).
|