Stem-loop sequence dmo-mir-9c

AccessionMI0009236 (change log)
DescriptionDrosophila mojavensis miR-9c stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
       uu    uuu         ucu    g     u  uuu  c 
5' auuu  gcug   cuuugguau   agcu uagau gu   ca a
   ||||  ||||   |||||||||   |||| ||||| ||   || u
3' uaaa  cgac   gaaaccaua   ucga aucua ua   gu a
       uu    cuc         uuu    a     c  --u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 7201345-7201433 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-9c
dmo-mir-9cscaffold_6500: 7201345-7201433 [+]
dmo-mir-306scaffold_6500: 7201957-7202027 [+]
dmo-mir-79scaffold_6500: 7202139-7202214 [+]
dmo-mir-9bscaffold_6500: 7202307-7202395 [+]
Database links

Mature sequence dmo-miR-9c

Accession MIMAT0008683
Sequence

13 - 

ucuuugguauucuagcuguaga

 - 34

Get sequence
Evidence by similarity; MI0000413

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).