Stem-loop sequence dmo-mir-274

AccessionMI0009208 (change log)
DescriptionDrosophila mojavensis miR-274 stem-loop
Gene family MIPF0000264; mir-274
Stem-loop
   u     --       c  a  cu        gu       ucu  u 
5'  uucgg  uuuguga cg ca  aacgggua  ugaggca   cg a
    |||||  ||||||| || ||  ||||||||  |||||||   ||  
3'  aaguc  aaacacu gc gu  uugcucau  auuuugu   gc u
   a     uu       a  -  uu        --       --c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6680: 18485494-18485580 [+]
intergenic
Database links

Mature sequence dmo-miR-274

Accession MIMAT0008655
Sequence

6 - 

guuugugaccgacacuaacggguagu

 - 31

Get sequence
Evidence by similarity; MI0000355

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).