Stem-loop sequence dmo-mir-306

AccessionMI0009202 (change log)
DescriptionDrosophila mojavensis miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
   --  u       uu            ucacauau     
5'   gc cagguac  agugacucucaa        ugcu 
     || |||||||  ||||||||||||        ||| u
3'   cg guccgug  ucgcugggaguu        acgu 
   gc  u       uc            ----ucau     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 7201957-7202027 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-306
dmo-mir-9cscaffold_6500: 7201345-7201433 [+]
dmo-mir-306scaffold_6500: 7201957-7202027 [+]
dmo-mir-79scaffold_6500: 7202139-7202214 [+]
dmo-mir-9bscaffold_6500: 7202307-7202395 [+]
Database links

Mature sequence dmo-miR-306-5p

Accession MIMAT0008648
Previous IDsdmo-miR-306
Sequence

3 - 

ucagguacuuagugacucucaa

 - 24

Get sequence
Evidence by similarity; MI0000414

Mature sequence dmo-miR-306-3p

Accession MIMAT0008649
Previous IDsdmo-miR-306*
Sequence

48 - 

gagggucgcucugugccugugc

 - 69

Get sequence
Evidence by similarity; MI0000414

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).