Stem-loop sequence bmo-mir-1926

AccessionMI0008394 (change log)
DescriptionBombyx mori miR-1926 stem-loop
Gene family MIPF0000452; mir-927
Literature search

4 open access papers mention bmo-mir-1926
(10 sentences)

Stem-loop
   gug     ua   c          -  aa          caacuacuu g 
5'    gcagu  uuu guuuuagaau cc  acgcuuugcc         g c
      |||||  ||| |||||||||| ||  ||||||||||         |  
3'    cgucg  aaa cgaaaucuua gg  ugcgaaaugg         c a
   -ua     ga   a          a  -a          --------- a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581679.1: 1013970-1014059 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-1926
bmo-mir-927NW_004581679.1: 1013971-1014058 [+]
bmo-mir-1926NW_004581679.1: 1013970-1014059 [-]
Database links

Mature sequence bmo-miR-1926

Accession MIMAT0007933
Sequence

64 - 

aggaauucuaaagcaaaaagg

 - 84

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).