Stem-loop sequence osa-MIR1881

AccessionMI0008287 (change log)
DescriptionOryza sativa miR1881 stem-loop
Literature search

2 open access papers mention osa-MIR1881
(2 sentences)

Stem-loop
                           a                                         c                   c                    aa  aagauuuguaccgcuggggaagugccagaagaaaagaacaaggaagacuugcuagca 
5' aaccaaguuaaaaugcucauaggu ugaacaagcaucaauguuauuguagcgugguggugugaccu ugugcacguaagcuugagg agcaaguucgacuccuucaa  gg                                                         g
   |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||  ||                                                          
3' uugguucaauuuuacgagugucca acuuguucguaguugcaauaacaucgcaucaccacacugga acacgugcguucgaacucc ucguucaagcugaggaaguu  uc                                                         g
                           g                                         u                   a                    cg  aagaagaaacaagaaaagaagaccuggaaaaaaaaagguucaaauggcaggaaaaca 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 5725922-5726259 [+]
intergenic
Database links

Mature sequence osa-miR1881

Accession MIMAT0007838
Sequence

38 - 

aauguuauuguagcgugguggugu

 - 61

Get sequence
Deep sequencing44 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).