Stem-loop sequence osa-MIR1870

AccessionMI0008273 (change log)
DescriptionOryza sativa miR1870 stem-loop
Literature search

3 open access papers mention osa-MIR1870
(8 sentences)

Stem-loop
   -u         -        g      -    ------        c                a     u      u    c          augguacuguugcccu 
5'   agugucaaa guaaugga gauuug ggaa      auaaacug guucaugcugaauuag ccuag gggcau uaua aucacaacac                u
     ||||||||| |||||||| |||||| ||||      |||||||| |||||||||||||||| ||||| |||||| |||| ||||||||||                 
3'   ucacaguuu cauuaccu cuaaac ccuu      uauuugau caaguacgacuuaauc ggauu cccgua auau uaguguugug                u
   au         u        a      u    accucu        a                g     u      u    c          auuccgaucuuuuucc 
Get sequence
Deep sequencing
3436 reads, 1.95e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 21164755-21164963 [+]
intergenic
Database links

Mature sequence osa-miR1870-5p

Accession MIMAT0007823
Previous IDsosa-miR1870
Sequence

44 - 

ugcugaauuagaccuagugggcau

 - 67

Get sequence
Deep sequencing2984 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

Mature sequence osa-miR1870-3p

Accession MIMAT0015270
Sequence

140 - 

uuuagggcuaauucagcaugaaca

 - 163

Get sequence
Deep sequencing30 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).