Stem-loop sequence osa-MIR1856

AccessionMI0008233 (change log)
DescriptionOryza sativa miR1856 stem-loop
Literature search

1 open access papers mention osa-MIR1856
(1 sentences)

Stem-loop
   --    cacu         aa             u  c         ccauaucau    accgaucaccgucuuuagc 
5'   agag    gcuaugcgu  gacggauucguac ac ugcguccga         gugc                   u
     ||||    |||||||||  ||||||||||||| || |||||||||         ||||                    
3'   ucuu    cgauacgca  cugccuaagcaug ug acguaggcu         uacg                   u
   uu    uuau         gg             c  u         ---------    acgaacguaaccaccucuc 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 10376148-10376296 [-]
intergenic
Database links

Mature sequence osa-miR1856

Accession MIMAT0007778
Sequence

11 - 

uaugcguaagacggauucgua

 - 31

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).