Stem-loop sequence osa-MIR1851

AccessionMI0008228 (change log)
DescriptionOryza sativa miR1851 stem-loop
Literature search

1 open access papers mention osa-MIR1851
(1 sentences)

Stem-loop
   -   a                         a  a        a  ---  c            a                      u             gcucccucccugccaucgccgccgcacgggcagcggagcccgcggcgcaguggcgacucuucgguugacggcggcuggcuacgcgguggcaacgaggaggcggcggcggccaggagcugcuccaccggccccacgcg 
5'  cag gugucuucgccaaaaugccaucccg ac gaaaugcc cu   uc ucuucuuccucc uccugcgcgugaagagcucgcc gcggccauggcua                                                                                                                                         c
    ||| ||||||||||||||||||||||||| || |||||||| ||   || |||||||||||| |||||||||||||||||||||| |||||||||||||                                                                                                                                          
3'  guc cacagaagcgguuuuacgguagggu ug cuuuacgg ga   ag agaagaaggagg agggcgcgcacuucucgagcgg cgccgguaccggu                                                                                                                                         a
   g   -                         c  c        g  ccg  a            c                      c             agagguggcggcgcggcuacggcggaacggcugccgcuagccccgcgacgggagggacgguaggggcgguugcggacacgucgacuccagcagcgccuuccugaggccgcugcugcgcgccuagggcggccgcgcgc 
Get sequence
Deep sequencing
596 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 26049315-26049785 [+]
intergenic
Database links

Mature sequence osa-miR1851

Accession MIMAT0007771
Sequence

439 - 

cgucugggauggcauuuuggc

 - 459

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).