Stem-loop sequence cel-mir-58b

AccessionMI0008204 (change log)
DescriptionCaenorhabditis elegans miR-58b stem-loop
Literature search

19 open access papers mention cel-mir-58b
(215 sentences)

Stem-loop 
   ---uga       ug          -      
5'       cucggug  ugaucucuua ccguu 
         |||||||  |||||||||| |||| u
3'       gaguuac  acuagagaau gguau 
   aaccua       ca          a
Get sequence
Deep sequencing
318 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 6660461-6660519 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-58b
cel-mir-58cchrIV: 6660634-6660712 [-]
cel-mir-58bchrIV: 6660461-6660519 [-]
Database links

Mature sequence cel-miR-58b-5p

Accession MIMAT0020361
Previous IDscel-miR-1834*
Sequence

2 -  

gacucggugugugaucucuua

 - 22

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [3]

Mature sequence cel-miR-58b-3p

Accession MIMAT0006776
Previous IDscel-miR-1834
Sequence

37 -  

agagaucaaccauugagauccaa

 - 59

Get sequence
Deep sequencing311 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
3
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).