Stem-loop sequence osa-MIR1442

AccessionMI0007030 (change log)
DescriptionOryza sativa miR1442 stem-loop
Gene family MIPF0000344; MIR818
Literature search

1 open access papers mention osa-MIR1442
(1 sentences)

Stem-loop
       u      ag      -       a      g acuag   -gg   u          aag       ----a       cuaagug    cu 
5' ucua auucau  uacuag auguguc caucca u     guu   ugu uuaugggacg   ggaguag     ucuuuug       gagg  a
   |||| ||||||  |||||| ||||||| |||||| |     |||   ||| ||||||||||   |||||||     |||||||       ||||   
3' aggu uaagua  augauc uacacag guaggu g     uag   aua aauacccugc   ccucauc     aggagac       cucu  a
       c      aa      c       c      g -guaa   gga   u          cua       auaug       --uacua    ua 
Get sequence
Deep sequencing
567 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 27589072-27589256 [+]
intergenic
Database links

Mature sequence osa-miR1442

Accession MIMAT0005992
Sequence

6 - 

auucauaguacuagaugugu

 - 25

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).