Stem-loop sequence osa-MIR1438

AccessionMI0007025 (change log)
DescriptionOryza sativa miR1438 stem-loop
Stem-loop
       u a   aag  u               c                          c  c    a  c     cuauguaaa       -ua  u 
5' guug g uau   gu uuaggguaauuuuau auuuuuaagaaaacaaaauuuaauac uu agau uu gguau         aaauuuu   ga c
   |||| | |||   || ||||||||||||||| |||||||||||||||||||||||||| || |||| || |||||         |||||||   ||  
3' uaac c aua   ca aaucccauuaaaaua uaaaaauucuuuuguuuuaaauuaug aa ucua aa ccaua         uuuaaaa   cu c
       u c   aua  u               u                          c  a    a  u     --------a       uaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 8429612-8429798 [+]
intergenic
Database links

Mature sequence osa-miR1438

Accession MIMAT0005989
Sequence

19 - 

aggguaauuuuaucauuuuuaa

 - 40

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).