Stem-loop sequence osa-MIR1437a

AccessionMI0007024 (change log)
Previous IDsosa-MIR1437
DescriptionOryza sativa miR1437 stem-loop
Gene family MIPF0001762; MIR1437
Literature search

1 open access papers mention osa-MIR1437a
(1 sentences)

Stem-loop
        c                              a                   a   gugaggug      ac      ca  gc      a   u 
5' gcgcg ggggagggagggaacggugccuagugcggc ccggagcucgccagcacgc gga        aggagg  ggcggc  gg  gcggag gcu g
   ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||        ||||||  ||||||  ||  |||||| |||  
3' cgcgc ccccucccuccuuugucacggaucacgccg ggccucgagcggucgugcg ccu        uccucc  ucgccg  cc  cgccuc cgg c
        a                              c                   -   --------      -a      --  ac      g   c 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3955902-3956089 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1437a
osa-MIR1437bChr8: 3955862-3956129 [-]
osa-MIR1437aChr8: 3955902-3956089 [+]
Database links

Mature sequence osa-miR1437a

Accession MIMAT0005988
Previous IDsosa-miR1437
Sequence

147 - 

uccggcgccgcacuaggcacug

 - 168

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).