Stem-loop sequence osa-MIR1435

AccessionMI0007021 (change log)
DescriptionOryza sativa miR1435 stem-loop
Gene family MIPF0000760; MIR1435
Literature search

3 open access papers mention osa-MIR1435
(4 sentences)

Stem-loop
         c            u    uu  a               --aaa          c    u  u   aaaa    -aug    a   u 
5' acuuuu uuaagucaaacu uuuu  ag uuugaucaaauuuau     aaaaauauag aaua uu uag    aaau    uuca uau a
   |||||| |||||||||||| ||||  || |||||||||||||||     |||||||||| |||| || |||    ||||    |||| ||| a
3' ugaaaa aauucaguuuga gaag  uc aaauuaguuuaaaua     uuuuuauauu uugu aa auc    uuua    aagu aug a
         a            u    uu  -               auauc          u    c  u   gugg    auca    a   u 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 29289280-29289462 [-]
intergenic
Database links

Mature sequence osa-miR1435

Accession MIMAT0005986
Sequence

4 - 

uuucuuaagucaaacuuuuu

 - 23

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).