![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-454 |
||||||||||
Accession | MI0006984 (change log) | |||||||||
Description | Gallus gallus miR-454 stem-loop | |||||||||
Gene family | MIPF0000174; mir-454 | |||||||||
Literature search |
4 open access papers mention gga-mir-454 | |||||||||
Stem-loop |
ccauuau -gcuuccuaa - u --- - - ug 5' cca ccuuaag ga gagacccuau caauauugc cu cugcuuu u ||| ||||||| || |||||||||| ||||||||| || ||||||| g 3' ggu ggaguuu cu uucugggaua guuauaacg ga gauggga c ------- acuucuuaug u u uuc u u cu |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence gga-miR-454-5p |
|
Accession | MIMAT0007291 |
Previous IDs | gga-miR-454* |
Sequence |
14 - uccuaaccuuaaggaugag - 32 |
Deep sequencing | 10 reads, 4 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
Mature sequence gga-miR-454-3p |
|
Accession | MIMAT0007292 |
Previous IDs | gga-miR-454 |
Sequence |
72 - uagugcaauauugcuuauagggu - 94 |
Deep sequencing | 4982 reads, 5 experiments |
Evidence | experimental; cloned [1-2], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18463306
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
2 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
3 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|