![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1197 |
||||||||||||||||||||||||||||
Accession | MI0006656 (change log) | |||||||||||||||||||||||||||
Symbol | HGNC:MIR1197 | |||||||||||||||||||||||||||
Description | Homo sapiens miR-1197 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||||
Literature search |
4 open access papers mention hsa-mir-1197 | |||||||||||||||||||||||||||
Stem-loop |
acuuccu -u ugc u gug g - uuu 5' gguauu gaaga ggu gaccaug u uacg c a |||||| ||||| ||| ||||||| | |||| | u 3' cuauaa cuucu uca cugguac g augc g u ------a cu --- u aca g a ugu |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||
Comments |
Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB5_330 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-1197 |
|
Accession | MIMAT0005955 |
Sequence |
57 - uaggacacauggucuacuucu - 77 |
Deep sequencing | 252 reads, 71 experiments |
Evidence | experimental; cloned [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18230126
"New miRNAs cloned from neuroblastoma"
BMC Genomics. 9:52(2008).
|