Stem-loop sequence hsa-mir-1266

AccessionMI0006403 (change log)
Symbol HGNC:MIR1266
DescriptionHomo sapiens miR-1266 stem-loop
Gene family MIPF0000615; mir-1266
Literature search

14 open access papers mention hsa-mir-1266
(24 sentences)

Stem-loop 
   --   --gg                u             --  g 
5'   aca    uagugucccucagggc guagaacagggcu  gg a
     |||    |||||||||||||||| |||||||||||||  || u
3'   ugu    gucacagggagucccg uaucuugucccga  uc u
   ac   acga                -             aa  a
Get sequence
Deep sequencing
603 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 52277117-52277200 [-]
antisense
OTTHUMT00000419349 ; MAPK6-002; intron 1
ENST00000560802 ; MAPK6-002; intron 1
Database links

Mature sequence hsa-miR-1266-5p

Accession MIMAT0005920
Sequence

13 -  

ccucagggcuguagaacagggcu

 - 35

Get sequence
Deep sequencing590 reads, 70 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-1266-3p

Accession MIMAT0026742
Sequence

49 -  

cccuguucuaugcccugaggga

 - 70

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).