![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1266 |
|||||
Accession | MI0006403 (change log) | ||||
Symbol | HGNC:MIR1266 | ||||
Description | Homo sapiens miR-1266 stem-loop | ||||
Gene family | MIPF0000615; mir-1266 | ||||
Literature search |
![]()
14 open access papers mention hsa-mir-1266 | ||||
Stem-loop |
-- --gg u -- g 5' aca uagugucccucagggc guagaacagggcu gg a ||| |||||||||||||||| ||||||||||||| || u 3' ugu gucacagggagucccg uaucuugucccga uc u ac acga - aa a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1266-5p |
|
Accession | MIMAT0005920 |
Sequence |
13 - ccucagggcuguagaacagggcu - 35 |
Deep sequencing | 590 reads, 70 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-1266-3p |
|
Accession | MIMAT0026742 |
Sequence |
49 - cccuguucuaugcccugaggga - 70 |
Deep sequencing | 7 reads, 7 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|