miRBase entry: hsa-mir-1256

Stem-loop hsa-mir-1256


Accession
MI0006390
Symbol
HGNC: MIR1256
Description
Homo sapiens hsa-mir-1256 precursor miRNA
Gene family
MIPF0000594; mir-1256

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1256 is a microRNA that has been implicated in various types of cancer, including breast cancer, bladder tumors, and prostate cancer [PMC9775590]. In a study validating miRNA expression in ameloblastoma tumors, MIR1256 was found to be inconsistently expressed compared to non-ameloblastoma controls [PMC5354851]. Additionally, MIR1256 was found to bind to circHECTD1 and participate in the Ago2 complex [PMC7216265]. In another study, gains covering MIR1256 were observed in a patient with prostate cancer [PMC9775590]. Interestingly, the alteration of MIR1256 was associated with a hazard ratio of less than 1 [PMC8108987]. Furthermore, miR1299 and miR548X were also found to be overexpressed in ameloblastomas [PMC7920560].

Overall, MIR1256 is a microRNA that has been implicated in various types of cancer and has been found to be inconsistently expressed in ameloblastoma tumors. It also plays a role in circHECTD1 binding and participates in the Ago2 complex. Additionally, gains covering MIR1256 have been observed in prostate cancer patients. The alteration of MIR1256 is associated with a hazard ratio of less than 1. Furthermore, miR1299 and miR548X have also been found to be overexpressed in ameloblastomas.

Literature search
4 open access papers mention hsa-mir-1256
(5 sentences)

Sequence

1430 reads, 59 reads per million, 58 experiments
agucagccuguugaagcuuugaagcuuugaugccAGGCAUUGACUUCUCACUAGCUgugaaaguccuagcuaaagagaagucaaugcaugacaucuuguuucaauagauggcuguuuca
(((((..((((((((((...........((((.((.(((((((((((((..((((((.((...)).))))))..))))))))))))).)).))))..)))))))))).)))))......

Structure
------     gc          uuugaagcuuu    c  G             AC      u  a 
      aguca  cuguugaagc           gaug cA GCAUUGACUUCUC  UAGCUg ga  
      |||||  ||||||||||           |||| || |||||||||||||  |||||| || a
      ucggu  gauaacuuug           cuac gu cguaacugaagag  aucgau cu  
acuuug     -a          ---------uu    a  a             aa      c  g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 20988314-20988432 [-]

Disease association
hsa-mir-1256 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1256

Accession MIMAT0005907
Description Homo sapiens hsa-miR-1256 mature miRNA
Sequence 35 - AGGCAUUGACUUCUCACUAGCU - 56
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621