Stem-loop sequence hsa-mir-1248

AccessionMI0006383 (change log)
Symbol HGNC:MIR1248
DescriptionHomo sapiens miR-1248 stem-loop
Gene family MIPF0000622; mir-1248
Literature search

16 open access papers mention hsa-mir-1248
(61 sentences)

Stem-loop 
   --------uuuac        auaa c   g     ---aa        c          
5'              cuucuugu    g acu ugcua     auugcaga acuaggacc 
                ||||||||    | ||| |||||     |||||||| |||||||| a
3'              gaagaaca    c uga acgau     uaacguuu ugguucugu 
   acgacaaugaaaa        --ca a   g     cguaa        u
Get sequence
Deep sequencing
11479 reads, 7.75 reads per million, 129 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 186786672-186786777 [+]
sense
OTTHUMT00000344405 ; ST6GAL1-007; intron 2
OTTHUMT00000344418 ; ST6GAL1-020; intron 2
OTTHUMT00000344404 ; ST6GAL1-006; intron 3
OTTHUMT00000344417 ; ST6GAL1-019; intron 3
OTTHUMT00000344400 ; ST6GAL1-002; intron 4
OTTHUMT00000344399 ; ST6GAL1-001; intron 5
ENST00000427315 ; ST6GAL1-007; intron 2
ENST00000442023 ; ST6GAL1-020; intron 2
ENST00000455441 ; ST6GAL1-006; intron 3
ENST00000448449 ; ST6GAL1-019; intron 3
ENST00000448044 ; ST6GAL1-002; intron 4
ENST00000457772 ; ST6GAL1-201; intron 4
ENST00000169298 ; ST6GAL1-001; intron 5
Database links

Mature sequence hsa-miR-1248

Accession MIMAT0005900
Sequence

4 -  

accuucuuguauaagcacugugcuaaa

 - 30

Get sequence
Deep sequencing10907 reads, 125 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).