![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1295a |
||||||
Accession | MI0006357 (change log) | |||||
Previous IDs | hsa-mir-1295 | |||||
Symbol | HGNC:MIR1295A | |||||
Description | Homo sapiens miR-1295a stem-loop | |||||
Gene family | MIPF0000676; mir-1295 | |||||
Stem-loop |
-- ug c u g aau 5' aggacauuu cccagauc guggccua uca a g ||||||||| |||||||| |||||||| ||| | u 3' uccuguaaa gggucuag cgccggau agu u g cc gu a u g ccg |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-1295a |
|
Accession | MIMAT0005885 |
Previous IDs | hsa-miR-1295 |
Sequence |
49 - uuaggccgcagaucuggguga - 69 |
Deep sequencing | 972 reads, 91 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|