Accession
MI0006336
Symbol
HGNC:
MIR663B
Description
Homo sapiens
hsa-mir-663b precursor miRNA
Gene family
MIPF0000462;
mir-663
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR663B is a down-regulated microRNA located in the intron of ANKDR30BL, and it is associated with various biological processes and diseases. In Immunity-H, genes such as SPRR3, CTGF, E2F5, MIR663B, and others have significantly higher mutation rates compared to Immunity-L [PMC9855412]. Previous studies have shown that silencing or knockout of POLRMT, a gene with higher mutation rates in Immunity-H, can inhibit cell proliferation and promote apoptosis [PMC9855412]. In patients with down-regulated MIR663B expression, there is a significant increase in the expression of genes associated with cell proliferation and migration [PMC7439310]. MIR663B has been found to regulate the expression of CCL17, CD40, and PIK3CD in chronic lymphocytic leukemia [PMC7439310]. Additionally, high expression of MIR663B is correlated with distant metastasis and advanced tumor grading in endometrial cancer patients [PMC5796233]. In endometrial cancer cells, PS suppresses MIR663B expression which plays an oncogenic role by upregulating pro-survival Bcl-2 and reducing apoptosis [PMC5796233]. The gene cluster on chromosome 2 contains an area between RNA5-8SP5 and MIR663B genes that includes Exp-MiBRs [PMC6792129]. Although there was no significant change in the expression of any miRNAs over time, there was a trend for an increase in MIR663B expression [PMC6416171].
Literature search
66 open access papers mention hsa-mir-663b
(264 sentences)
(264 sentences)
Sequence
140
reads,
74
reads per million, 45 experiments
ggugccgagggccguccggcauccuaggcgggucgcugcgguaccucccuccugucuguggcggugggaucccguggccguguuuuccuGGUGGCCCGGCCGUGCCUGAGGuuuc
...(((..((((((.((((..(((((((((.(..(((((((....((((.((.(((...))))).))))..)))))))).))....))))).)).)))).)).))))..)))...
...(((..((((((.((((..(((((((((.(..(((((((....((((.((.(((...))))).))))..)))))))).))....))))).)).)))).)).))))..)))...
Structure
ggu ga - u ca - ---- g uc uacc u u u gcc gggc cg ccgg uc cuagg cg g gcugcgg uccc cc guc ||| |||| || |||| || ||||| || | ||||||| |||| || ||| g uGG UCCG GC GGCC GG GGucc gu c cggugcc aggg gg cgg cuu AG U C -C U uuuu g -- --cu u - u
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr2: 132256966-132257080 [-]
Disease association
hsa-mir-663b is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-663b
| Accession | MIMAT0005867 |
| Description | Homo sapiens hsa-miR-663b mature miRNA |
| Sequence | 90 - GGUGGCCCGGCCGUGCCUGAGG - 111 |
| Evidence |
experimental
miRAP [1] |
| Database links |
|
| Predicted targets |
|
References
|
