![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-934 |
|||||
Accession | MI0005756 (change log) | ||||
Symbol | HGNC:MIR934 | ||||
Description | Homo sapiens miR-934 stem-loop | ||||
Gene family | MIPF0000542; mir-934 | ||||
Literature search |
5 open access papers mention hsa-mir-934 | ||||
Stem-loop |
c a uagu 5' agaaauaaggcuucugucua uacuggagac cugg a |||||||||||||||||||| |||||||||| |||| u 3' ucuuuauuccgagggcaggu augaccucug gacc a a a caaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-934 |
|
Accession | MIMAT0004977 |
Sequence |
15 - ugucuacuacuggagacacugg - 36 |
Deep sequencing | 2311 reads, 84 experiments |
Evidence | experimental; cloned [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|