Stem-loop sequence hsa-mir-922

AccessionMI0005714 (change log)
Symbol HGNC:MIR922
DescriptionHomo sapiens miR-922 stem-loop
Gene family MIPF0000536; mir-922
Literature search

3 open access papers mention hsa-mir-922
(4 sentences)

Stem-loop 
          uu   --c    -c    ----   ggac      cag 
5' auggcgu  ucc   ucuc  cugu    ccu    uggggu   a
   |||||||  |||   ||||  ||||    |||    ||||||    
3' uacugca  agg   agag  gacg    gga    gccccg   c
          uc   aua    ac    aaga   ----      ugu
Get sequence
Deep sequencing
40 reads, 17.2 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 197674496-197674576 [-]
sense
OTTHUMT00000339732 ; IQCG-003; intron 1
OTTHUMT00000339737 ; IQCG-008; intron 1
OTTHUMT00000339738 ; IQCG-009; intron 1
OTTHUMT00000339739 ; IQCG-010; intron 1
OTTHUMT00000339730 ; IQCG-001; intron 2
OTTHUMT00000339733 ; IQCG-004; intron 2
OTTHUMT00000339736 ; IQCG-007; intron 2
ENST00000455191 ; IQCG-003; intron 1
ENST00000416896 ; IQCG-008; intron 1
ENST00000463651 ; IQCG-009; intron 1
ENST00000452735 ; IQCG-010; intron 1
ENST00000265239 ; IQCG-001; intron 2
ENST00000453254 ; IQCG-004; intron 2
ENST00000480302 ; IQCG-007; intron 2
Database links

Mature sequence hsa-miR-922

Accession MIMAT0004972
Sequence

57 -  

gcagcagagaauaggacuacguc

 - 79

Get sequence
Deep sequencing12 reads, 11 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).