![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-920 |
|||||
Accession | MI0005712 (change log) | ||||
Symbol | HGNC:MIR920 | ||||
Description | Homo sapiens miR-920 stem-loop | ||||
Gene family | MIPF0000495; mir-920 | ||||
Literature search |
![]()
4 open access papers mention hsa-mir-920 | ||||
Stem-loop |
--- ag - aaga - agga 5' gu uuguu cuacag ccugga ugugu g || ||||| |||||| |||||| ||||| 3' ca gacga gguguc ggaccu acaca c gca au a gagg c gaau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-920 |
|
Accession | MIMAT0004970 |
Sequence |
51 - ggggagcuguggaagcagua - 70 |
Deep sequencing | 6 reads, 4 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17573847
"Analysis of gene expression in normal and neoplastic human testis: new roles of RNA"
Int J Androl. 30:316-326(2007).
|